ID: 1111200265_1111200277

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1111200265 1111200277
Species Human (GRCh38) Human (GRCh38)
Location 13:84927484-84927506 13:84927525-84927547
Sequence CCCGAACTGTGCAACCCACGGAT GACCCACGCCACCGGGGCCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!