ID: 1111221238_1111221245

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1111221238 1111221245
Species Human (GRCh38) Human (GRCh38)
Location 13:85207813-85207835 13:85207863-85207885
Sequence CCTAGAGACTTGTTGAATGATTT CAATGAAGTCCAGGCTGAGGTGG
Strand - +
Off-target summary No data {0: 490, 1: 1361, 2: 1982, 3: 1478, 4: 1076}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!