ID: 1111253545_1111253556

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1111253545 1111253556
Species Human (GRCh38) Human (GRCh38)
Location 13:85638377-85638399 13:85638396-85638418
Sequence CCTGGCTCCCACGCCTGCCAAGG AAGGGTGAGCAGGGTGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 169, 3: 291, 4: 505} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!