ID: 1111474346_1111474348

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1111474346 1111474348
Species Human (GRCh38) Human (GRCh38)
Location 13:88725582-88725604 13:88725604-88725626
Sequence CCAGTTCTGTGGACTGGAGTGAA AAACTTATGGTGCTTTTTCCAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 10, 3: 47, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!