ID: 1111498683_1111498690

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1111498683 1111498690
Species Human (GRCh38) Human (GRCh38)
Location 13:89088240-89088262 13:89088293-89088315
Sequence CCTACGCCCACGGACTCTCGCTG GCAAGGCGGCAGCCAGACTGGGG
Strand - +
Off-target summary {0: 2, 1: 1065, 2: 989, 3: 833, 4: 1027} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!