ID: 1111542632_1111542635

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1111542632 1111542635
Species Human (GRCh38) Human (GRCh38)
Location 13:89689058-89689080 13:89689089-89689111
Sequence CCTCGTGCTGGGCTAGGCTCAGA ACCAGAGTAGCATGTGATCTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 23, 3: 132, 4: 491} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!