ID: 1111592461_1111592470

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1111592461 1111592470
Species Human (GRCh38) Human (GRCh38)
Location 13:90367845-90367867 13:90367898-90367920
Sequence CCCTTGGTGTTTCAGTAACAGAA GGAGGCCGAGGAAAAGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 35, 3: 110, 4: 394} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!