ID: 1111663836_1111663844

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1111663836 1111663844
Species Human (GRCh38) Human (GRCh38)
Location 13:91243185-91243207 13:91243238-91243260
Sequence CCGCATTTATAGTCACGTAAATC GGTTGATACAAATTGAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!