|
Left Crispr |
Right Crispr |
| Crispr ID |
1111703951 |
1111703958 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:91724712-91724734
|
13:91724746-91724768
|
| Sequence |
CCAGGCATGGTGGCATGCGCCTA |
CTCTGTAAGGCCAAGGTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 77, 1: 1625, 2: 12226, 3: 41937, 4: 100622} |
{0: 2, 1: 49, 2: 1951, 3: 28559, 4: 85237} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|