ID: 1111718034_1111718042

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1111718034 1111718042
Species Human (GRCh38) Human (GRCh38)
Location 13:91905400-91905422 13:91905451-91905473
Sequence CCAAATCCCTAATGAATACTGGA TACAAAAAGAAGTGGGTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 166} {0: 1, 1: 0, 2: 0, 3: 10, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!