ID: 1111765082_1111765090

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1111765082 1111765090
Species Human (GRCh38) Human (GRCh38)
Location 13:92517559-92517581 13:92517612-92517634
Sequence CCAGGCAAACAGGGTCTGGAGTG CTGAGGGTCTGACTGTTAGAAGG
Strand - +
Off-target summary {0: 2880, 1: 2381, 2: 1178, 3: 583, 4: 480} {0: 3, 1: 9, 2: 12, 3: 45, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!