|
Left Crispr |
Right Crispr |
| Crispr ID |
1111765085 |
1111765090 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:92517584-92517606
|
13:92517612-92517634
|
| Sequence |
CCTCTGGCAAACTCCAGCAGACC |
CTGAGGGTCTGACTGTTAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 101, 2: 1840, 3: 3046, 4: 2096} |
{0: 3, 1: 9, 2: 12, 3: 45, 4: 241} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|