ID: 1111822776_1111822783

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1111822776 1111822783
Species Human (GRCh38) Human (GRCh38)
Location 13:93233772-93233794 13:93233788-93233810
Sequence CCTGGGGAGACTGGTCAGTGAGT AGTGAGTGGGGAGAGGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 192} {0: 1, 1: 1, 2: 17, 3: 232, 4: 2152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!