ID: 1111822776_1111822784

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1111822776 1111822784
Species Human (GRCh38) Human (GRCh38)
Location 13:93233772-93233794 13:93233789-93233811
Sequence CCTGGGGAGACTGGTCAGTGAGT GTGAGTGGGGAGAGGGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 192} {0: 1, 1: 0, 2: 16, 3: 153, 4: 1421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!