ID: 1111822776_1111822785

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1111822776 1111822785
Species Human (GRCh38) Human (GRCh38)
Location 13:93233772-93233794 13:93233796-93233818
Sequence CCTGGGGAGACTGGTCAGTGAGT GGGAGAGGGGTGTGGGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 192} {0: 1, 1: 0, 2: 8, 3: 159, 4: 1187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!