ID: 1111828306_1111828311

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1111828306 1111828311
Species Human (GRCh38) Human (GRCh38)
Location 13:93296289-93296311 13:93296334-93296356
Sequence CCCTCTAGTACCACTGTCACTGT ATTTTCTCTCAGTTGGATTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 157} {0: 1, 1: 0, 2: 2, 3: 25, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!