ID: 1111838360_1111838364

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1111838360 1111838364
Species Human (GRCh38) Human (GRCh38)
Location 13:93417534-93417556 13:93417560-93417582
Sequence CCTCCTGTGCTGAATTACTTCTT TGAAATAACCAAAATGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 296} {0: 1, 1: 0, 2: 3, 3: 31, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!