|
Left Crispr |
Right Crispr |
Crispr ID |
1111844929 |
1111844934 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:93496117-93496139
|
13:93496162-93496184
|
Sequence |
CCCAGCCTTGCTGCCTCCTTGCA |
TAGCAATCAGCGAGAGTCCGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 430, 2: 2217, 3: 2057, 4: 1350} |
{0: 2, 1: 1411, 2: 1161, 3: 881, 4: 953} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|