ID: 1111859824_1111859826

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1111859824 1111859826
Species Human (GRCh38) Human (GRCh38)
Location 13:93688708-93688730 13:93688745-93688767
Sequence CCTAGAGTGGGCAAATTCGTAGA TAGAAGTTATAAAGTGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 48, 3: 417, 4: 1185} {0: 1, 1: 0, 2: 2, 3: 21, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!