ID: 1111895782_1111895788

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1111895782 1111895788
Species Human (GRCh38) Human (GRCh38)
Location 13:94139802-94139824 13:94139834-94139856
Sequence CCTGCCTGTTTCCTTAGTCATAT CCACCAGCTGTAGCTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 212} {0: 1, 1: 0, 2: 1, 3: 28, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!