ID: 1111897784_1111897788

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1111897784 1111897788
Species Human (GRCh38) Human (GRCh38)
Location 13:94162473-94162495 13:94162492-94162514
Sequence CCTGTGACACACTCAGTGGCTGG CTGGGGCTTGAGTGTGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 12, 4: 177} {0: 1, 1: 0, 2: 1, 3: 27, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!