ID: 1111937682_1111937686

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1111937682 1111937686
Species Human (GRCh38) Human (GRCh38)
Location 13:94573320-94573342 13:94573373-94573395
Sequence CCCAGTAGATAAAATGACTTGGT CCACCCCAGAACTACCATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 212} {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!