ID: 1111940510_1111940514

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1111940510 1111940514
Species Human (GRCh38) Human (GRCh38)
Location 13:94601987-94602009 13:94602011-94602033
Sequence CCAGGGTAAGACCCTGCGGGGCA CTTCAGCAGCACCGCGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 92} {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!