|
Left Crispr |
Right Crispr |
| Crispr ID |
1111989693 |
1111989699 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:95104264-95104286
|
13:95104282-95104304
|
| Sequence |
CCACCACTCCCAGCTAATTTTTG |
TTTTGGGTTTTTAGTAAAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 795, 1: 36661, 2: 100031, 3: 172447, 4: 200784} |
{0: 1, 1: 258, 2: 13954, 3: 218117, 4: 144584} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|