ID: 1112033840_1112033847

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1112033840 1112033847
Species Human (GRCh38) Human (GRCh38)
Location 13:95479949-95479971 13:95479983-95480005
Sequence CCATCTTCACACTGCTAATAAAG ACTGGGGAATTTATAAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 121, 2: 1390, 3: 1914, 4: 3587} {0: 2, 1: 126, 2: 430, 3: 679, 4: 885}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!