|
Left Crispr |
Right Crispr |
| Crispr ID |
1112033840 |
1112033849 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:95479949-95479971
|
13:95479994-95480016
|
| Sequence |
CCATCTTCACACTGCTAATAAAG |
TATAAAGGAAGGAGGTTTAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 121, 2: 1390, 3: 1914, 4: 3587} |
{0: 8, 1: 736, 2: 1080, 3: 1755, 4: 2080} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|