ID: 1112035869_1112035873

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1112035869 1112035873
Species Human (GRCh38) Human (GRCh38)
Location 13:95496109-95496131 13:95496159-95496181
Sequence CCTTTCTCAGGCTGTGTCTGCAT CCCTCGCCTATACAACTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 367} {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!