|
Left Crispr |
Right Crispr |
| Crispr ID |
1112039678 |
1112039679 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:95534256-95534278
|
13:95534270-95534292
|
| Sequence |
CCTTCAAATAGGAAAGAAAAAGA |
AGAAAAAGAAGAAGAAAACATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 11, 3: 176, 4: 1792} |
{0: 1, 1: 10, 2: 187, 3: 1405, 4: 9102} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|