ID: 1112041684_1112041692

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1112041684 1112041692
Species Human (GRCh38) Human (GRCh38)
Location 13:95553326-95553348 13:95553367-95553389
Sequence CCAGAGTTCATGCTGCAGGGGCT CCCCTACGTTCCCCGAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 175} {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!