ID: 1112061694_1112061698

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1112061694 1112061698
Species Human (GRCh38) Human (GRCh38)
Location 13:95746827-95746849 13:95746863-95746885
Sequence CCAGTGAGAATCTCATTCTTTAT CTGATTACTCAGCTGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 312} {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!