ID: 1112064489_1112064492

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1112064489 1112064492
Species Human (GRCh38) Human (GRCh38)
Location 13:95778449-95778471 13:95778496-95778518
Sequence CCAAATGAATGGATACATATAAA TTACTCAGCTTTTAAAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 554} {0: 1, 1: 6, 2: 21, 3: 244, 4: 1047}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!