ID: 1112066107_1112066108

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1112066107 1112066108
Species Human (GRCh38) Human (GRCh38)
Location 13:95794886-95794908 13:95794905-95794927
Sequence CCTAATATTTGAAATGGGTCTCA CTCAGACATGTCTACAAATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 56, 4: 413} {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!