ID: 1112073063_1112073066

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1112073063 1112073066
Species Human (GRCh38) Human (GRCh38)
Location 13:95876331-95876353 13:95876345-95876367
Sequence CCTGAATTTGTGGGGGCTGGCCT GGCTGGCCTGGCATTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 171} {0: 1, 1: 2, 2: 4, 3: 47, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!