ID: 1112105051_1112105059

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1112105051 1112105059
Species Human (GRCh38) Human (GRCh38)
Location 13:96231189-96231211 13:96231234-96231256
Sequence CCTTACTGTGCCTGTTGATCCTG ATTTTGATTCATTAGGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 153} {0: 1, 1: 25, 2: 171, 3: 661, 4: 1809}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!