ID: 1112125696_1112125699

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1112125696 1112125699
Species Human (GRCh38) Human (GRCh38)
Location 13:96465256-96465278 13:96465299-96465321
Sequence CCAGAGAACTTTTGCATATTTGT ATATTCTTAGCAACAGAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 508} {0: 1, 1: 0, 2: 3, 3: 29, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!