ID: 1112131375_1112131380

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1112131375 1112131380
Species Human (GRCh38) Human (GRCh38)
Location 13:96527551-96527573 13:96527595-96527617
Sequence CCTGAGGCTCTGCTGGGAAAGAC GGTCAGATAAAGCATCTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 243} {0: 1, 1: 0, 2: 1, 3: 16, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!