ID: 1112142960_1112142974

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1112142960 1112142974
Species Human (GRCh38) Human (GRCh38)
Location 13:96666251-96666273 13:96666287-96666309
Sequence CCCACCATGATTCAATTACCTTC TGATGACATGGGGGGATTATAGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 153, 3: 345, 4: 580} {0: 1, 1: 2, 2: 45, 3: 516, 4: 1606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!