|
Left Crispr |
Right Crispr |
| Crispr ID |
1112142967 |
1112142977 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:96666276-96666298
|
13:96666312-96666334
|
| Sequence |
CCAGGTCCCTCTGATGACATGGG |
CTACAATTCAAGGCGAGATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 39, 3: 396, 4: 1283} |
{0: 2, 1: 324, 2: 5701, 3: 9152, 4: 8704} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|