ID: 1112144519_1112144520

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1112144519 1112144520
Species Human (GRCh38) Human (GRCh38)
Location 13:96682699-96682721 13:96682724-96682746
Sequence CCAGTAAGGAAAGAAGCTCTTGT TGATATTTTAAAATAAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 246} {0: 1, 1: 0, 2: 11, 3: 143, 4: 1244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!