ID: 1112157519_1112157532

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1112157519 1112157532
Species Human (GRCh38) Human (GRCh38)
Location 13:96833810-96833832 13:96833858-96833880
Sequence CCCACATCCTACAAAATCCTGAC CTTCCATCTTTTAGGGAACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 164} {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!