ID: 1112196886_1112196894

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1112196886 1112196894
Species Human (GRCh38) Human (GRCh38)
Location 13:97235036-97235058 13:97235082-97235104
Sequence CCTTCTTAGGGACACGCAGAGCA TGTTGAACCATTTCTCTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96} {0: 1, 1: 0, 2: 0, 3: 16, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!