ID: 1112203404_1112203409

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1112203404 1112203409
Species Human (GRCh38) Human (GRCh38)
Location 13:97300680-97300702 13:97300726-97300748
Sequence CCTTCAACATCTTTACTCCACTA ATTGATCTGCTTCAAAAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 182} {0: 1, 1: 0, 2: 1, 3: 20, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!