ID: 1112204039_1112204047

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1112204039 1112204047
Species Human (GRCh38) Human (GRCh38)
Location 13:97306424-97306446 13:97306476-97306498
Sequence CCATCTTCTTTCCTCTTCTTCAA CTCTGAGAGCAAACTCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 199, 4: 1476} {0: 1, 1: 0, 2: 2, 3: 7, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!