|
Left Crispr |
Right Crispr |
| Crispr ID |
1112216355 |
1112216366 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:97434394-97434416
|
13:97434432-97434454
|
| Sequence |
CCGGGGCTGGGGGCGCAGCGCGG |
GTCGCGGGCGGCGGCGGCGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 11, 3: 100, 4: 545} |
{0: 1, 1: 18, 2: 105, 3: 1705, 4: 3705} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|