ID: 1112239204_1112239210

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1112239204 1112239210
Species Human (GRCh38) Human (GRCh38)
Location 13:97664330-97664352 13:97664377-97664399
Sequence CCCAGGGGATGCAAAATCGCTCT ATGCTCCCCCTTAAGATGTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!