ID: 1112267588_1112267597

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1112267588 1112267597
Species Human (GRCh38) Human (GRCh38)
Location 13:97939314-97939336 13:97939359-97939381
Sequence CCCTGGTGCATCTGTGCATGCAG AAATAAGCTGCAGGCTCCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!