ID: 1112281496_1112281509

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1112281496 1112281509
Species Human (GRCh38) Human (GRCh38)
Location 13:98066597-98066619 13:98066644-98066666
Sequence CCACCCAAATCTCATCTTGAATG TGTGAGAGGGACCCGGTGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!