ID: 1112300117_1112300123

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1112300117 1112300123
Species Human (GRCh38) Human (GRCh38)
Location 13:98222560-98222582 13:98222597-98222619
Sequence CCGTTAGGATAATACAACATGTT CTGTGACAGGTGCCAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207} {0: 1, 1: 0, 2: 1, 3: 27, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!