ID: 1112321728_1112321731

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1112321728 1112321731
Species Human (GRCh38) Human (GRCh38)
Location 13:98414000-98414022 13:98414014-98414036
Sequence CCTTCATGGTGGCTTTGGCTGGC TTGGCTGGCTCCCCATTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196} {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!