ID: 1112324228_1112324239

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1112324228 1112324239
Species Human (GRCh38) Human (GRCh38)
Location 13:98432767-98432789 13:98432818-98432840
Sequence CCTGTACTGGGCGTGTGAGGGAG GGACCCACTGGAGGGTCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98} {0: 1, 1: 0, 2: 8, 3: 63, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!